Mutacje somatyczne i zarodkowe genu HRPT2 w sporadycznym raku przytarczyc cd

Po wykryciu mutacji w DNA guza, te same eksony lub introny w odpowiednich próbkach DNA linii zarodkowej, gdy są dostępne, zostały zsekwencjonowane w podobny sposób. Wzmocnione egzony, dla których sekwencjonowanie w obu kierunkach pokazało czysty chromatogram i pozornie normalną sekwencję po jednej stronie specyficznej pozycji nukleotydowej, a następnie niejasną sekwencję po drugiej, interpretowano jako sugerującą mutację przesunięcia ramki. W celu ostatecznego określenia, czy wstawka lub delecja była obecna w tych przypadkach, lub w celu potwierdzenia utraty określonego allelu w jednym przypadku, amplifikowane eksony powtórzono po klonowaniu w celu oddzielenia alleli. Produkty PCR klonowano do wektora PCR4-TOPO przy użyciu zestawu do klonowania TOPO TA (Invitrogen), transformowano do Escherichia coli i umieszczano na agarze LB, do którego dodano 50 .g ampicyliny na mililitr. Następnie zebrano od 8 do 10 odrębnych kolonii i ponownie zawieszono w mieszaninie PCR w celu amplifikacji i sekwencjonowania. Sekwencjonowanie wszystkich egzonów HRPT2 (1, 2, 3, 4, 5, 7 i 14), dla których zidentyfikowano mutacje linii zarodkowej w tym badaniu (lub w grupach z zespołem HPT-JT19) przeprowadzono w sposób opisany uprzednio19 w 150 niespokrewnione zdrowe osoby kontrolne.
Analiza utraty heterozykozy
Przeanalizowaliśmy 17 dopasowanych par próbek linii germinalnej i DNA nowotworu od 11 pacjentów pod kątem utraty heterozygotyczności w locus HRPT2 przez genotypowanie czterech markerów mikrosatelitarnych. D1S542 i D1S413 flankują HRPT2 odpowiednio na stronach centromerowych i telomerycznych (Working Draft projektu z Uniwersytetu Kalifornijskiego w Santa Cruz, dostępne pod adresem http://genome.ucsc.edu). Przeanalizowaliśmy również bazę danych sekwencji ludzkich genomów dla wcześniej nie zgłoszonych sekwencji powtórzeń dinukleotydowych w obrębie HRPT2, które mogą służyć jako podstawa dla nowych wewnątrzgenowych polimorfizmów HRPT2, zidentyfikowaliśmy dwa takie regiony w intronie 10 i intronie 14 i zaprojektowaliśmy startery z unikalnych sekwencji flankujących dla Amplifikacja PCR: 5 TGATTTCTCATGCATTTCCTG3 (primer przedni intronu 10), 5 TAACTACCTGAAACCCATCAC3 (starter odwrotny intron 10), 5 AATTAGTGTCACAGTATCTTA3 (primer intron 14 przedni) i 5 CTCAAAGTATCTATTAGGTA3 (starter reverse intron 14). Te nowe markery wewnątrzgatunkowe były wysoce polimorficzne, wykazując znaczne częstotliwości heterozygotyczności u naszych pacjentów: 60 procent dla intronu 10 i 50 procent dla intronu 14. Po elektroforezie wyznakowanych fluorescencyjnie produktów w sekwenatorze ABI Prism 377 następowała analiza wzoru za pomocą Genescan oraz Genotyper software (Applied Biosystems) .27 Anelaryczną nierównowagę zidentyfikowano na podstawie analizy wysokości pików alleli w próbkach nowotworowych i kontrolnych27 i uznano, że wskazuje ona na utratę heterozygotyczności, gdy udział allelu mniejszościowego był wielokrotnie pomijalny.
Wyniki
Zidentyfikowaliśmy mutacje HRPT2 w raku przytarczyc od 10 z 15 pacjentów z pozornie sporadyczną chorobą. Przewiduje się, że wszystkie mutacje dezaktywują kodowane białko, parafibrominę, która również występuje w zespole HPT-JT.19 W 12 nowotworach z 10 z 15 pacjentów zidentyfikowano łącznie 15 różnych mutacji HRPT2, obejmujących sześć egzonów (Tabela 1). ). Pięć mutacji spowodowało bezpośrednio przedwczesny kodon stop, a 10 dało zmienioną ramkę odczytu, zazwyczaj z kodonem wczesnego stopu, również po krótkiej zmianie w ramce odczytu (Tabela 1)
[przypisy: leczenie po przeszczepie skóry, stomatolog toruń cennik, półpasiec ile trwa ]
[hasła pokrewne: zniesienie lordozy, enolaza, dexacaps ]